si:dkey-174k18.7

Ensembl ID:
ENSDARG00000076781
ZFIN ID:
ZDB-GENE-070912-389
Human Orthologue:
TRIM45
Human Description:
tripartite motif-containing 45 [Source:HGNC Symbol;Acc:19018]
Mouse Orthologue:
Trim45
Mouse Description:
tripartite motif-containing 45 Gene [Source:MGI Symbol;Acc:MGI:1918187]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41396 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114362 Nonsense 85 574 1 6
ENSDART00000141775 Nonsense 50 539 1 6
Genomic Location (Zv9):
Chromosome 9 (position 21560071)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20715857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGTGAAGACAACTCTGGCTCTGGCTCCACAATCCTATGTCCCCAGTG[T/A]GATTCAGAGGTGGATCTGCCGCCGTCGGGTGTGGATGGGCTGACCACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link