LOC100333350

Ensembl ID:
ENSDARG00000076776
Mouse Orthologue:
Gucy2g
Mouse Description:
guanylate cyclase 2g Gene [Source:MGI Symbol;Acc:MGI:106025]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11316 Nonsense Available for shipment Available now
sa22134 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22135 Nonsense Available for shipment Available now
sa6264 Nonsense Mutation detected in F1 DNA During 2016
sa35329 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031154 Nonsense 173 1127 2 21
Genomic Location (Zv9):
Chromosome 12 (position 33150067)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31348064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAAAAGGGTGGGAGAGAWCCTTCTTAAAGCATTGGAATTTTTCGGATG[G/A]AAGCATGTTGGCATGATCGGAGGCGGAGCGGATGCAAATACGTGGGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031154 Essential Splice Site 385 1127 5 21
Genomic Location (Zv9):
Chromosome 12 (position 33151747)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31349744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGAAATTGTCCAAAAACTCAGGGACAGGACAAGCATTAGATTTTATGG[T/A]AATTTTAGGGTATTTTTATGATAATGGTAGTTTTTTTTTTGACTATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031154 Nonsense 408 1127 6 21
Genomic Location (Zv9):
Chromosome 12 (position 33151903)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31349900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGATGAATATGGAGAGAGGAACCTAGATTATTCAGTATATGACCTG[C/T]AACAAACAGAAACTTTAATACAATTTGTCTCTGTTTTGGATTTTGACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031154 Nonsense 809 1127 14 21
Genomic Location (Zv9):
Chromosome 12 (position 33157987)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31355984
KASP Assay ID:
554-5027.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGTGAAAACCCAGACCACAGACCCCCGTTCGGCAGTATCAGAAGA[C/T]AACTGAGAGACGCTTGTCCTGAAAGGTAAATACTTRATANNNNNTAAATGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031154 Essential Splice Site 987 1127 17 21
Genomic Location (Zv9):
Chromosome 12 (position 33161460)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31359457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCACCTGCCCAATGAGAGACTAGCCCTACGGATTGGGATTAATTCTGG[T/A]ATGCAATTATACACTTTATTTATAAACTAAGTGTATTGAGGCGTATACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link