si:dkey-100g3.2

Ensembl ID:
ENSDARG00000076773
ZFIN ID:
ZDB-GENE-090312-76
Description:
leucine rich repeat containing 58 [Source:RefSeq peptide;Acc:NP_001139094]
Human Orthologue:
LRRC58
Human Description:
leucine rich repeat containing 58 [Source:HGNC Symbol;Acc:26968]
Mouse Orthologue:
Lrrc58
Mouse Description:
leucine rich repeat containing 58 Gene [Source:MGI Symbol;Acc:MGI:2443542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19568 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114746 Nonsense 79 351 1 4

The following transcripts of ENSDARG00000076773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47983634)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46795295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGATATCAGCAATAACGCGCTCACGGTCATACCAGATGACATTATG[C/T]GATTGAAGAACTTAAAGACGTTTGTTGCAAAGAATAATCTTTTGAACGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link