REPS2

Ensembl ID:
ENSDARG00000076768
Description:
RALBP1 associated Eps domain containing 2 [Source:HGNC Symbol;Acc:9963]
Human Orthologue:
REPS2
Human Description:
RALBP1 associated Eps domain containing 2 [Source:HGNC Symbol;Acc:9963]
Mouse Orthologue:
Reps2
Mouse Description:
RALBP1 associated Eps domain containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:2663511]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24405 Nonsense Available for shipment Available now
sa32466 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115161 Nonsense 18 656 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41183018)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41015872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATCCGGGATCCGCCGGTGGGACCTTCATGTCCCTGAGCGACACCGAG[C/T]AGAGATGTTACTCCGGGCTGTACGCGCTCTGTCAGCCCGACAGCAGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115161 Nonsense 561 656 17 19
Genomic Location (Zv9):
Chromosome 23 (position 41262371)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41095086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCTCTTTTAACATGTAAACTTCTTACCAGGATTGTTCGTTGGTACAC[C/T]AGGGCCACGCCCCTCAGAAGCCAATGCGGAGAAAACTCCACCCAGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link