PGF (1 of 2)

Ensembl ID:
ENSDARG00000076767
Description:
placental growth factor [Source:HGNC Symbol;Acc:8893]
Human Orthologue:
PGF
Human Description:
placental growth factor [Source:HGNC Symbol;Acc:8893]
Mouse Orthologue:
Pgf
Mouse Description:
placental growth factor Gene [Source:MGI Symbol;Acc:MGI:105095]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7440 Missense Mutation detected in F1 DNA During 2017
sa14929 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114220 Missense 92 131 2 5
Genomic Location (Zv9):
Chromosome 17 (position 44915154)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44635027
KASP Assay ID:
554-4275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCCAGGAATATGTGGAGATGACCTTTGTGGAGCACAAAGCCTGTGAA[T/C]GTAGGTAAGGGAAAACATCYATTCAGTTTATKTAASCACTGTGYTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114220 Nonsense 101 131 3 5
Genomic Location (Zv9):
Chromosome 17 (position 44915361)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44635234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTCTTTTCTTTYACATTGTGATTCCAAGACTAAGAAAACCTACAACAAAA[C/T]AAGACAGGTAACAAGTTGTGCTACACTTACGCATTTTTGTTAATATAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link