ddhd2

Ensembl ID:
ENSDARG00000076765
ZFIN ID:
ZDB-GENE-080519-4
Human Orthologue:
DDHD2
Human Description:
DDHD domain containing 2 [Source:HGNC Symbol;Acc:29106]
Mouse Orthologue:
Ddhd2
Mouse Description:
DDHD domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1919358]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15207 Nonsense Available for shipment Available now
sa6168 Nonsense Mutation detected in F1 DNA During 2017
sa9324 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 458 678 11 17
Genomic Location (Zv9):
Chromosome 10 (position 20589440)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20550854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGAAACCATCATGATYCTCAAACCCCYACCACTAGTGCTGTTGAYTA[T/A]CAGCATTTCGATGTGGGCATTGGACAAGTAAGTRTTGGTGTTTAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 605 678 15 17
Genomic Location (Zv9):
Chromosome 10 (position 20586565)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20547979
KASP Assay ID:
554-5474.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTTTTTAAATGACTCAACTAATATTTGAACATTTGTGCAAAAGCATG[T/A]CCTGTGGAGCAGGAGGACAGCAATGTCAAGGTGGGAATGTTGAATCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114824 Nonsense 675 678 17 17
Genomic Location (Zv9):
Chromosome 10 (position 20584619)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20546033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATTCTTCAGATACCAAACACTGTGYCTTTAAGACAGTGTMCAGATCA[C/T]AGCCACCGGGAAGTCTKTTCATTTCCCATTTWTCCGTCTGGAATAGTGCS
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link