si:dkey-146d24.2

Ensembl ID:
ENSDARG00000076755
ZFIN ID:
ZDB-GENE-090313-184
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JKA7]
Human Orthologue:
C20orf29
Human Description:
chromosome 20 open reading frame 29 [Source:HGNC Symbol;Acc:15875]
Mouse Orthologue:
2310035K24Rik
Mouse Description:
RIKEN cDNA 2310035K24 gene Gene [Source:MGI Symbol;Acc:MGI:1916846]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22250 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112771 Essential Splice Site 154 196 None 3
ENSDART00000138867 Essential Splice Site 106 148 None 3

The following transcripts of ENSDARG00000076755 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 14767496)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14775491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCACGTCACTGTCTGGAGGAGCTGCGTCTGCTGGGACCCGGTGCTGAGG[T/C]CAGACTTTCATTGGACTAATGAGTGTTTTATTAGAGGAGCTGTTATTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link