tmem67

Ensembl ID:
ENSDARG00000076752
ZFIN ID:
ZDB-GENE-080716-1
Human Orthologue:
TMEM67
Human Description:
transmembrane protein 67 [Source:HGNC Symbol;Acc:28396]
Mouse Orthologue:
Tmem67
Mouse Description:
transmembrane protein 67 Gene [Source:MGI Symbol;Acc:MGI:1923928]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14889 Nonsense Available for shipment Available now
sa22858 Nonsense Mutation detected in F1 DNA During 2014
sa14183 Nonsense Available for shipment Available now
sa22859 Nonsense Mutation detected in F1 DNA During 2014
sa3962 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111245 Nonsense 328 991 11 29
ENSDART00000140460 Nonsense 321 982 10 28

The following transcripts of ENSDARG00000076752 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 29798094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTWTTCACCAAYCGTTCTGCTGCTTTCAGAACACCAACATTGAGTTG[C/T]GAGCTGCTGTGTACTCAGTGCGTGGRGARTTTCTGAGATGGGAAAGYGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111245 Nonsense 390 991 13 29
ENSDART00000140460 Nonsense 383 982 12 28

The following transcripts of ENSDARG00000076752 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 29799104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTATCTGTGTCAGAGCTCTTAACTGGTTATCCAGAGCCTTTGTTCTA[T/A]GATGTGTTCCTGGTCATTCAGAATTCCCAAGACAATCGTCTTCTTGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111245 Nonsense 486 991 15 29
ENSDART00000140460 Nonsense 479 982 14 28

The following transcripts of ENSDARG00000076752 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 29799552)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAATACACAGAAGGGACAGGTTTACCCTCCACTGATGAGTGTGGCCTA[C/A]TCGGATATACAGATCAAAGACCCCAGCACACAGACTGTTACTGTAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111245 Nonsense 779 991 24 29
ENSDART00000140460 Nonsense 770 982 23 28

The following transcripts of ENSDARG00000076752 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 29806766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTTATATGTGTGTGTCATTTAGATCTCAGTTCTGCTGCTGTCTCAT[C/T]GATGTTTTGGCTACTACATTCATGGGCGCTCTGTTCATGGTCATGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111245 Nonsense 828 991 25 29
ENSDART00000140460 Nonsense 819 982 24 28

The following transcripts of ENSDARG00000076752 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 29806989)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTGTGGCCAAAGGGGACTTTTGCCAAACTCTGATACTCAGACGTTT[C/T]AGATTTCGATAACTAACCGTCTGCGAGCACAGTATGATCGGATAATCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lwcib9kj