ntn2

Ensembl ID:
ENSDARG00000076748
ZFIN ID:
ZDB-GENE-050310-2
Description:
netrin 2 [Source:RefSeq peptide;Acc:NP_001032492]
Human Orthologue:
NTN3
Human Description:
netrin 3 [Source:HGNC Symbol;Acc:8030]
Mouse Orthologue:
Ntn3
Mouse Description:
netrin 3 Gene [Source:MGI Symbol;Acc:MGI:1341188]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12171 Essential Splice Site Available for shipment Available now
sa24556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112318 Essential Splice Site None 600 3 8
Genomic Location (Zv9):
Chromosome 24 (position 40269958)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38868749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGGTTRATTTACTTTGATTTATTGACAATTTGTGCCTTTCCATTTCC[A/T]GACGCACGCTGCCGAGGGTCGATTTYGGGAAAGTCGTCTATCTCCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112318 Nonsense 227 600 3 8
Genomic Location (Zv9):
Chromosome 24 (position 40269035)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38867826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGCGCCCATCGGGGAAGGACTTTGACTCGAGTCCTGTGCTTCAGGATT[G/A]GGTGACGGTCACTGATATTCGGGTGGTGTTCAGTCGTCCGCAGCACACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link