si:dkey-206d17.5

Ensembl ID:
ENSDARG00000076744
ZFIN ID:
ZDB-GENE-081104-358
Description:
hypothetical protein LOC100190889 [Source:RefSeq peptide;Acc:NP_001129051]
Mouse Orthologue:
AC167669.3
Mouse Description:
cDNA sequence BC024659 (BC024659), mRNA [Source:RefSeq DNA;Acc:NM_001135577]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16890 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112870 Essential Splice Site 26 88 None 2
ENSDART00000142825 Essential Splice Site 26 88 None 3
Genomic Location (Zv9):
Chromosome 19 (position 2805968)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3783616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGTGATCGTGGCCACGCTGATATGTGTCCTCCTCTTCATGCTCTTCGG[T/G]GAGTGAWCAAAWCAAACAMACAAACATCCTMAGAAAAGCATCCTGCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link