cyth1

Ensembl ID:
ENSDARG00000076742
ZFIN ID:
ZDB-GENE-030131-657
Description:
cytohesin-1 [Source:RefSeq peptide;Acc:NP_999847]
Human Orthologue:
CYTH1
Human Description:
cytohesin 1 [Source:HGNC Symbol;Acc:9501]
Mouse Orthologue:
Cyth1
Mouse Description:
cytohesin 1 Gene [Source:MGI Symbol;Acc:MGI:1334257]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16210 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003066 Nonsense 19 398 2 13
ENSDART00000090771 Nonsense 19 398 2 14
ENSDART00000125439 Nonsense 19 399 2 14
Genomic Location:
Chromosome 3 (position 58317097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTTCTGTATTTTTTCCTMAGTGCCCGACGACCTCACRCCAGAGGAG[C/T]AAAAAGAGCTGGAAAACATCCGGCGCCGAAAGCAGGAGCTGCTGGACGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ov35un9n