si:dkey-193c22.2

Ensembl ID:
ENSDARG00000076735
ZFIN ID:
ZDB-GENE-070705-337
Description:
Novel protein similar to vertebrate chondroitin sulfate proteoglycan 4 (Melanoma-associated) (CSPG4)
Mouse Orthologue:
BC067074
Mouse Description:
cDNA sequence BC067074 Gene [Source:MGI Symbol;Acc:MGI:3040697]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15427 Nonsense Available for shipment Available now
sa20499 Nonsense Available for shipment Available now
sa40521 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114078 Nonsense 933 2304 2 11
ENSDART00000142897 Nonsense 933 2370 2 9
Genomic Location (Zv9):
Chromosome 5 (position 41855420)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39630137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGAAGTTAATGCGAATCAACTNNNTGTCTAACTCTACCAAAGAYTTTGAC[A/T]AAATTATGTCCTTTACTAATCAGGATGTTCTTGAAGAGCGTATTATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114078 Nonsense 1728 2304 9 11
ENSDART00000142897 Nonsense 1726 2370 9 9
Genomic Location (Zv9):
Chromosome 5 (position 41872200)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39646917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCTACTCACCAAACAACCTGAATCCAAACGTAGCTCTTATGAGATTT[G/A]GTACCAGGTCACTTCACTTCCACAGCATGGCGTCATCGTTGTGGGGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114078 Essential Splice Site 2205 2304 None 11
ENSDART00000142897   2203 2370 9 9
Genomic Location (Zv9):
Chromosome 5 (position 41873632)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39648349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGCGTGACCAAATCCGGGTCAAGATTTAAAGGTCGCAACCGCTGGGG[T/C]AATTCAAACAGCATTGACATTGGTACCACTAACTCAAAAACAACCCATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link