myo9al1

Ensembl ID:
ENSDARG00000076729
ZFIN ID:
ZDB-GENE-080424-5
Human Orthologue:
MYO9A
Human Description:
myosin IXA [Source:HGNC Symbol;Acc:7608]
Mouse Orthologue:
Myo9a
Mouse Description:
myosin IXa Gene [Source:MGI Symbol;Acc:MGI:107735]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21098 Nonsense Available for shipment Available now
sa21099 Nonsense Mutation detected in F1 DNA During 2014
sa11190 Nonsense Available for shipment Available now
sa12066 Essential Splice Site Available for shipment Available now
sa12095 Essential Splice Site Available for shipment Available now
sa15001 Essential Splice Site Available for shipment Available now
sa25371 Nonsense Mutation detected in F1 DNA During 2014
sa8288 Nonsense Mutation detected in F1 DNA During 2014
sa3638 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7606 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 10 2522 1 42
Genomic Location:
Chromosome 7 (position 58153169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGGAAACTGCTGCTCCAATATGAGTGTTCATGATGTTGGCGGTAGA[C/T]GACGCTTTGAGGACTCCGAGCTCACCCTGCGCATCTACCCGGGGATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 82 2522 1 42
Genomic Location:
Chromosome 7 (position 58153387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGAAGGAGTTCGGTGGGGAGGAGTGGATTCTCAACCCCACCGATTA[T/A]CCCGTCCAGCGCATGATGCTATGGCCTCGCATGGCACTGGAGAACCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 329 2522 3 42
Genomic Location:
Chromosome 7 (position 58218441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGCATATGTRGAGAAATACCTGCTGGAGAAGTCCAGACTCGTCTAY[C/T]AGGAACACAATGAAAGGTAGAAGACGTTGTGCWGTTATTAACYAATACTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 662 2522 12 42
Genomic Location:
Chromosome 7 (position 58280521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTTCATCATTAAACACTATGCAGGAAAAGTCAAATATGGTGTGAAG[G/A]TCAGTGCTGAWTACRGCTACACWCWWATGCTAMGTTCTGTGTTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 831 2522 16 42
Genomic Location:
Chromosome 7 (position 58297802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACTCTACSAGCAGTAAACTCCTGGAGCGAGCCCATGGCATCCTYATG[T/C]AAGAGTCTCTCTCTGATRCACACAGCTTTAGCTTTACYGTCATTGTTMAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 912 2522 19 42
Genomic Location:
Chromosome 7 (position 58301763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGTCACAGCCRTACTTTGTRAAGTGCATACGATCAAACKCAGAGAAG[G/A]TKTGCGAGTCTTYGTGAATATATTGTGRTTATATATCATAMAGGTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 1786 2522 28 42
Genomic Location:
Chromosome 7 (position 58322299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTCGAGAACGGTTGTTGTGTGGCAGCGATACTTTAGAAGGAGACTA[C/A]ACTGAAGCGACACTTCTGATGGAAGAGGGTGAGACGAGGGGAAAACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 2025 2522 34 42
Genomic Location:
Chromosome 7 (position 58328197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGNAAAATGAGAATGAATGAGATGTCTGTGTCTTGTGTAGTGTGCCGCTA[T/G]GCGTGTCACAGAAAGTGCTGTCAGAAAATGACCACCAAATGCAGCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 2150 2522 36 42
Genomic Location:
Chromosome 7 (position 58330306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCTCTGATGACCTTTGAACTGTATGAGGAATTCCTGCGRGCCATGGG[T/A]AAGCAGATGTGCACTGGTGTGATCGATCATGCTTAKTGCATTAGCRTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Missense 2201 2522 38 42
Genomic Location:
Chromosome 7 (position 58338484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGATTGCCTTGCAGGAGGAAACAAACCGCATGTCCGCGAATGCGCTG[G/A]CTATCGTGTTYGCCCCCTGTATCCTGCGCTGCCCTGACACCATCGACCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5zpnqrog