pi4kaa

Ensembl ID:
ENSDARG00000076724
ZFIN ID:
ZDB-GENE-100204-2
Description:
phosphatidylinositol 4-kinase alpha [Source:RefSeq peptide;Acc:NP_001030144]
Human Orthologue:
PI4KA
Human Description:
phosphatidylinositol 4-kinase, catalytic, alpha [Source:HGNC Symbol;Acc:8983]
Mouse Orthologue:
Pi4ka
Mouse Description:
phosphatidylinositol 4-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:2448506]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8479 Nonsense Mutation detected in F1 DNA During 2018
sa8903 Nonsense Mutation detected in F1 DNA During 2018
sa41573 Nonsense Mutation detected in F1 DNA During 2018
sa44718 Nonsense Mutation detected in F1 DNA During 2018
sa2547 Nonsense F2 line generated During 2018
sa2563 Essential Splice Site F2 line generated During 2018
sa34812 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Nonsense 40 2097 2 55
Genomic Location (Zv9):
Chromosome 10 (position 3265570)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3257764
GRCz11 10 3258068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTWAWATGCACATTTGTTAAATATAGGTCCAGAAGCTACAATGCATGTG[T/A]CCTGTGGACATCCGTGGTGTTTTCCAGCTGGACGAGCGGAGGAGAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Nonsense 405 2097 11 55
Genomic Location (Zv9):
Chromosome 10 (position 3254886)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3247080
GRCz11 10 3247384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGCAGCAGTCAGTCTGAGCTGCARAGGATCCTGCACGATGTGGAGTA[T/A]CTGCACAGTGAACTGAACCCGCTTAAGCTGCGCTGTCAGGCCAACGCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Nonsense 620 2097 16 55
Genomic Location (Zv9):
Chromosome 10 (position 3247174)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3239368
GRCz11 10 3239672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCGCTGTGGCTCTGAGAGACACTCCACGAGTGATGGAGCCCATCTTA[C/T]AGATCCTGCAGCAGAAGTTCTGCCAGCCGCCGTCTCAGCTCGACGTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Nonsense 759 2097 20 55
Genomic Location (Zv9):
Chromosome 10 (position 3240141)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3232335
GRCz11 10 3232639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGGATATGTTGTTCATAATCTGTCTGTTTTTTACCCTATAGCTAACC[A/T]AACGTTTGCCGGCCATAAAAGAAGCCAAACCGAGGCTGCAGAAGCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2547
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Nonsense 1156 2097 31 55
Genomic Location (Zv9):
Chromosome 10 (position 3228369)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3220563
GRCz11 10 3220867
KASP Assay ID:
554-2640.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCYGAGGCCACGCGGAGCACATCAGACCTGAATAAACTGATGATCCGA[C/T]AGATGAATGAAGCTCTGGATGGAGGACAGCCCGAAGCCTTCACCGAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2563
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Essential Splice Site 1367 2097 36 55
Genomic Location (Zv9):
Chromosome 10 (position 3217790)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3209984
GRCz11 10 3210288
KASP Assay ID:
554-3190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATTTTKGCATAATAGCTTTAATTCTAATATATTTTGTTGTTCTCTTT[A/G]GTGTGGCATCAAAGTTCCCCACTYAGGGAGACAAGCGTCTGCGGGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113162 Nonsense 1819 2097 48 55
Genomic Location (Zv9):
Chromosome 10 (position 3203481)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3195675
GRCz11 10 3195979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGTGTTCTCCTAAGTGGTCTCTCTGTGTGTGTGCAGGTCTGCGCTG[T/A]CCGTCCGACTCTCAGGATGAAGGAGATGAGAGCTCACTGACGGCTCAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link