ENSDARG00000076722

Ensembl ID:
ENSDARG00000076722
Human Orthologues:
AP005117.2, FAM38B
Human Descriptions:
family with sequence similarity 38, member B [Source:HGNC Symbol;Acc:26270]
Transmembrane protein C18orf30 [Source:UniProtKB/Swiss-Prot;Acc:Q8N787]
Mouse Orthologue:
Fam38b
Mouse Description:
family with sequence similarity 38, member B Gene [Source:MGI Symbol;Acc:MGI:1918781]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111325 Nonsense 2172 2444 38 43
Genomic Location:
Chromosome 2 (position 54930745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATCAAATCCGTCACTGGGGCAGAATTTAAGAAGTTCACAGATCACTA[C/A]AAGTCTAAYGCAGTAAGTGYCTGTTGTCAAATTACAGYMGATACTATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v17vstrd