ANKRD34A

Ensembl ID:
ENSDARG00000076719
Description:
ankyrin repeat domain 34A [Source:HGNC Symbol;Acc:27639]
Human Orthologues:
ANKRD34A, ANKRD34C
Human Descriptions:
ankyrin repeat domain 34A [Source:HGNC Symbol;Acc:27639]
ankyrin repeat domain 34C [Source:HGNC Symbol;Acc:33888]
Mouse Orthologues:
Ankrd34a, Ankrd34c
Mouse Descriptions:
ankyrin repeat domain 34A Gene [Source:MGI Symbol;Acc:MGI:3617846]
ankyrin repeat domain 34C Gene [Source:MGI Symbol;Acc:MGI:2685617]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2877 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2877
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110547 Nonsense 385 516 1 1
Genomic Location:
Chromosome 16 (position 45637636)
KASP Assay ID:
554-3380.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCATCCCTGGATCTCCAGATTCTGGACGTGTCTCGGTTGARCGCCGC[A/T]AATACAAYGCCTCTCCATTGTCATTGCTCACCAGCTCTTCTCGAGAGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r88yj88a