NP_956049.1

Ensembl ID:
ENSDARG00000076717
Description:
U4/U6 small nuclear ribonucleoprotein Prp4 [Source:RefSeq peptide;Acc:NP_956049]
Human Orthologue:
PRPF4
Human Description:
PRP4 pre-mRNA processing factor 4 homolog (yeast) [Source:HGNC Symbol;Acc:17349]
Mouse Orthologue:
Prpf4
Mouse Description:
PRP4 pre-mRNA processing factor 4 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1917302]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33729 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111950 Essential Splice Site 204 507 6 14
Genomic Location (Zv9):
Chromosome 5 (position 59570274)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56776924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATCTACACGAACAATTAAACAGCAAGAGCTTCACAAGAACTTGCGGG[T/C]ACGACAGCATGTCAAGAAAATGAAAAAAAAAATCTATATTTGTCTTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link