palb2

Ensembl ID:
ENSDARG00000076716
ZFIN ID:
ZDB-GENE-090313-43
Description:
Fanconi N [Source:UniProtKB/TrEMBL;Acc:B5TXG1]
Human Orthologue:
PALB2
Human Description:
partner and localizer of BRCA2 [Source:HGNC Symbol;Acc:26144]
Mouse Orthologue:
Palb2
Mouse Description:
partner and localizer of BRCA2 Gene [Source:MGI Symbol;Acc:MGI:3040695]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19427 Nonsense Available for shipment Available now
sa19426 Nonsense Available for shipment Available now
sa19425 Nonsense Available for shipment Available now
sa19424 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113013   None 459 None 8
ENSDART00000128550 Nonsense 357 1294 4 12
ENSDART00000142132   None 131 None 5
Genomic Location (Zv9):
Chromosome 1 (position 8207743)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8447548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACGCATGGCTGCATCTAACAGCTCCATCGATCTAGATGCTGTCATTTA[T/G]AGCCAGCTCACAGGAGGGCGAGGCAGACGCAGACTGAGCCAATCCCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113013   None 459 None 8
ENSDART00000128550 Nonsense 395 1294 4 12
ENSDART00000142132   None 131 None 5
Genomic Location (Zv9):
Chromosome 1 (position 8207631)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8447436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGGTGACCCCAGAGCGTTCAGAACCAGTCTGTAGGACCACTGACCAA[C/T]AAAGAGGCAGAGGAAGAGGACGGAGAGGGAGGAGAGGACGTCGAAGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113013   None 459 None 8
ENSDART00000128550 Nonsense 523 1294 5 12
ENSDART00000142132   None 131 None 5
Genomic Location (Zv9):
Chromosome 1 (position 8207160)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8446965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGTTGTTTTTTATTTTGCATTTTAGATCAGTCGCCATTTTTGCCAT[C/A]ATTAACTTCACTTATCCAGGGTCTTCAAGAAAAGAAAACAACAAGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113013   None 459 None 8
ENSDART00000128550 Nonsense 806 1294 5 12
ENSDART00000142132   None 131 None 5
Genomic Location (Zv9):
Chromosome 1 (position 8206312)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8446117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGGATTCAGACACCATCTGAAATGACTCAAGAGTCAATACCAAAAGCT[C/T]AAAATAATGTGAAACTGAATATGTCTTCTCAGAGGAACATTGCATTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link