si:dkey-194n13.3

Ensembl ID:
ENSDARG00000076703
ZFIN ID:
ZDB-GENE-090312-102
Description:
Novel protein similar to vertebrate AN1, ubiquitin-like, homolog (Xenopus laevis) (ANUBL1) [Source:U
Human Orthologue:
ANUBL1
Human Description:
AN1, ubiquitin-like, homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:23504]
Mouse Orthologue:
Anubl1
Mouse Description:
AN1, ubiquitin-like, homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1914742]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22262 Essential Splice Site Available for shipment Available now
sa35450 Nonsense Mutation detected in F1 DNA During 2017
sa31916 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109123 Essential Splice Site 174 637 5 8
ENSDART00000134477   None 182 None 5
ENSDART00000146772 Essential Splice Site 173 673 6 10
Genomic Location (Zv9):
Chromosome 13 (position 18087642)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17907677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCACTATTAAACACAAATAATGAGAGTTACTTATTTTGTGTGCTTTC[A/G]GTGGTGCTTCTGTACGAAATGTGCGCGCAGAGGAGGAGGAGGAACAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109123 Nonsense 252 637 6 8
ENSDART00000134477   None 182 None 5
ENSDART00000146772 Nonsense 251 673 7 10
Genomic Location (Zv9):
Chromosome 13 (position 18082733)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17902768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGGTCCGCGACCTTGCAGCGGTTCCCACGGCTCTGCCCGACACCAT[C/T]GAATGTTCCGTGTCCTTCCTCAAATAGGACACGCCTCTTCAACACATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109123 Nonsense 394 637 6 8
ENSDART00000134477   None 182 None 5
ENSDART00000146772 Nonsense 393 673 7 10
Genomic Location (Zv9):
Chromosome 13 (position 18082307)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17902342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAACCACAGTTATTGAGTCGCCCAAAGCTGTGCCCTTCAATCTTCCT[G/T]AACCCCTGAGTTTGGATGTATCTGCTCAGCGAGAGCGAAGTCTGAACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link