LOC559305

Ensembl ID:
ENSDARG00000076701
Human Orthologue:
B4GALNT4
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 4 [Source:HGNC Symbol;Acc:26315]
Mouse Orthologue:
B4galnt4
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 4 Gene [Source:MGI Symbol;Acc:MGI:2652891]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11710 Essential Splice Site Available for shipment Available now
sa14580 Essential Splice Site Available for shipment Available now
sa3630 Nonsense Mutation detected in F1 DNA During 2014
sa21055 Nonsense Mutation detected in F1 DNA During 2014
sa21056 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Essential Splice Site 182 1167 5 20
Genomic Location:
Chromosome 7 (position 50637025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTATGGCCTTAGAGTATTTGGATTCATTCATCCTTACAAAGATGG[T/C]CAGTGTATTTCRTCAAGTTTATANTTTTTTTACAAKATTTCATCAAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Essential Splice Site 215 1167 6 20
Genomic Location:
Chromosome 7 (position 50646400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGAYGAGAGTCCGCTCAATGCCCGGCTYCTGGTGTWYGTGGGACAGG[T/A]GCGTTCTTWAATGCATGACCCTTYAATAAACCKRACCGCACTTCTGAGAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 311 1167 10 20
Genomic Location:
Chromosome 7 (position 50703450)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCGTACATCACATCCCACAGACACTGGCCAGTCACTCTCTCGCTCTG[C/T]AGATCTACCACAGGACAGAGACACACACTGCAGACATGCTCAAACCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 378 1167 12 20
Genomic Location:
Chromosome 7 (position 50711432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCATCATATTTTGTTTTATATTTCTAGGTCTACCTTTCCTATGTGTA[T/A]CCCAATGACTTCACCAGACTTACTCATATGGAGAAAACCAACAAATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067857 Nonsense 566 1167 14 20
Genomic Location:
Chromosome 7 (position 50714478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGACTCCCAAACACTTTCTCTGGTTCAGAGAGGGCGTTCTTTGGCATG[G/A]GTGCTGCCTGACCCTGCACTGCAGAGCGAAAGTAAACTGATTGAAACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oz8d951m