ENSDARG00000076698

Ensembl ID:
ENSDARG00000076698
Human Orthologues:
GPR171, GPR87, P2RY12, P2RY13, P2RY14
Human Descriptions:
G protein-coupled receptor 171 [Source:HGNC Symbol;Acc:30057]
G protein-coupled receptor 87 [Source:HGNC Symbol;Acc:4538]
purinergic receptor P2Y, G-protein coupled, 12 [Source:HGNC Symbol;Acc:18124]
purinergic receptor P2Y, G-protein coupled, 13 [Source:HGNC Symbol;Acc:4537]
purinergic receptor P2Y, G-protein coupled, 14 [Source:HGNC Symbol;Acc:16442]
Mouse Orthologues:
Gpr171, Gpr87, P2ry12, P2ry13, P2ry14
Mouse Descriptions:
G protein-coupled receptor 171 Gene [Source:MGI Symbol;Acc:MGI:2442043]
G protein-coupled receptor 87 Gene [Source:MGI Symbol;Acc:MGI:1934133]
purinergic receptor P2Y, G-protein coupled 12 Gene [Source:MGI Symbol;Acc:MGI:1918089]
purinergic receptor P2Y, G-protein coupled 13 Gene [Source:MGI Symbol;Acc:MGI:1921441]
purinergic receptor P2Y, G-protein coupled, 14 Gene [Source:MGI Symbol;Acc:MGI:2155705]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42475 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110800 Nonsense 251 258 2 2
Genomic Location (Zv9):
Chromosome 15 (position 3884056)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3819608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACTTATTTACTTTTTCTTTTGCAAGGCATTTAGAGACAAGGTTAACT[T/A]AATTAGTTGTCAAAACTGTCCATAAATAAGGGACATATTATTTAGGTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link