dlg2

Ensembl ID:
ENSDARG00000076691
ZFIN ID:
ZDB-GENE-050221-3
Description:
Disks large homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5PYH7]
Human Orthologue:
DLG2
Human Description:
discs, large homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:2901]
Mouse Orthologue:
Dlg2
Mouse Description:
discs, large homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344351]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34928 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004069 Essential Splice Site 202 846 6 23
ENSDART00000078822   None 881 None 24
ENSDART00000136135 Essential Splice Site 159 501 5 13
Genomic Location (Zv9):
Chromosome 10 (position 30304133)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAAAAATCATTCCTGGGGGAGCAGCGGCTGAAGACGGCAGACTCAGG[T/C]GGGACAGTGTCTCTAAACACACTTGTTTACTGTTATTATGAAATCATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004069 Nonsense 582 846 15 23
ENSDART00000078822   None 881 None 24
ENSDART00000136135   None 501 None 13
Genomic Location (Zv9):
Chromosome 10 (position 30417158)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29791933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTATGGAGACATTCTTCACGTCATTAATGCGTCTGATGATGAATGGT[G/A]GCAGGCCAGAAGAGTGACGCCCGAGGGGGACAGTGAGGAGATGGGCGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link