gramd1a

Ensembl ID:
ENSDARG00000076689
ZFIN ID:
ZDB-GENE-060503-688
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8E7Q9]
Human Orthologue:
GRAMD1A
Human Description:
GRAM domain containing 1A [Source:HGNC Symbol;Acc:29305]
Mouse Orthologue:
Gramd1a
Mouse Description:
GRAM domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:105490]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36228 Nonsense Mutation detected in F1 DNA During 2017
sa32108 Nonsense Available for shipment Available now
sa22923 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111956 Nonsense 2 896 1 18
ENSDART00000142648   None 771 None 20

The following transcripts of ENSDARG00000076689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44725041)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42005549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGTCTTCGAGGAAACTGTCAGTAGACTCTCATTAAACAGGTGATGTA[T/G]GAAGGTCTTTTAGTGATGGCGATGACGACACCACCTGAAATCCTAATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111956 Nonsense 360 896 7 18
ENSDART00000142648 Nonsense 226 771 8 20

The following transcripts of ENSDARG00000076689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44696981)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41977489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGTGTTACGGCACTGAGCTCGGCCTGACCAGTGAAGATGATGACTA[C/A]GTCTCCCCTACTGCTGAACATATGAACGGCCTGCTGTGAGTCCATACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111956 Essential Splice Site 372 896 7 18
ENSDART00000142648 Essential Splice Site 238 771 8 20

The following transcripts of ENSDARG00000076689 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 44696944)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41977452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGATGACTACGTCTCCCCTACTGCTGAACATATGAACGGCCTGCTG[T/C]GAGTCCATACTGACACAAATCTGCTCTGGAAAAAGGTTTTATAAAATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link