DSP (2 of 2)

Ensembl ID:
ENSDARG00000076673
Description:
desmoplakin [Source:HGNC Symbol;Acc:3052]
Human Orthologue:
DSP
Human Description:
desmoplakin [Source:HGNC Symbol;Acc:3052]
Mouse Orthologue:
Dsp
Mouse Description:
desmoplakin Gene [Source:MGI Symbol;Acc:MGI:109611]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37182 Nonsense Mutation detected in F1 DNA During 2017
sa37181 Nonsense Mutation detected in F1 DNA During 2017
sa43550 Nonsense Mutation detected in F1 DNA During 2017
sa43549 Missense, Nonsense Mutation detected in F1 DNA During 2017
sa39311 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111078 Nonsense 40 1491 2 7
ENSDART00000126556   None 640 None 2
Genomic Location (Zv9):
Chromosome 20 (position 53203857)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53055467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATGCTGCTTTATTATAATGCGTTTTTGTGTCCTTCAGGTGTCTTCTT[T/A]AAATGCGCACTACTTGGAACTGCTCACCCGCTCAAGCGATTACTACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111078 Nonsense 100 1491 3 7
ENSDART00000126556   None 640 None 2
Genomic Location (Zv9):
Chromosome 20 (position 53200448)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53052078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAACTGAGGGATGCCATCAAAGACCAAACTGCCAACAATGCATCTTTA[C/T]AGGATGCTCTTCTGCAATACCAGCAAGAGCTGAACAATTCCCAAAGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111078 Nonsense 816 1491 4 7
ENSDART00000126556   None 640 None 2
Genomic Location (Zv9):
Chromosome 20 (position 53197412)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53049042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGCTCTTGCAGAACTTTGAACAAGAGAGAACAGAGATGCAGGCACTT[C/T]GAGACTCGAAGCAGGAGTTGCTGAGACTGCAGCAGAAACCAGATGGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111078 Missense 1231 1491 7 7
ENSDART00000126556 Nonsense 371 640 2 2
Genomic Location (Zv9):
Chromosome 20 (position 53195377)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53047007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGCATTGAGAGCACCTCAGAGTACCTTCAGCAAGATCAATCCTCAG[C/A]AAACTCCTCCAAGCACATTTCCAGCATGTCAGTCAAACTATCCCCATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111078 Nonsense 1247 1491 7 7
ENSDART00000126556 Nonsense 387 640 2 2
Genomic Location (Zv9):
Chromosome 20 (position 53195329)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53046959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAACTCCTCCAAGCACATTTCCAGCATGTCAGTCAAACTATCCCCAT[T/A]AGTAGAATCGATTGAAGAACAGAATCCAGTTGGAGCGATCTTTGACACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link