ccng1

Ensembl ID:
ENSDARG00000076667
ZFIN ID:
ZDB-GENE-020322-1
Description:
cyclin-G1 [Source:RefSeq peptide;Acc:NP_955775]
Human Orthologue:
CCNG1
Human Description:
cyclin G1 [Source:HGNC Symbol;Acc:1592]
Mouse Orthologue:
Ccng1
Mouse Description:
cyclin G1 Gene [Source:MGI Symbol;Acc:MGI:102890]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38991 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109065 Essential Splice Site 199 299 4 6
ENSDART00000138274   None 161 None 3

The following transcripts of ENSDARG00000076667 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 23139711)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21839501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCACAGTTAAAGGCATGCCATTGCTCATTTACTTTCACTAAACTAAAG[G/A]TAAGCAGCATCATTATTATTATTATTATTATTATTATTATTATCTTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link