ENSDARG00000076665

Ensembl ID:
ENSDARG00000076665
Human Orthologue:
ZBED1
Human Description:
zinc finger, BED-type containing 1 [Source:HGNC Symbol;Acc:447]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39787 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32863 Nonsense Mutation detected in F1 DNA During 2016
sa38320 Nonsense Mutation detected in F1 DNA During 2016
sa13106 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113139 Essential Splice Site 22 630 2 5
Genomic Location (Zv9):
Chromosome 2 (position 14321407)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14619451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATAGGGCTGTAGTCAGTGAAGAAGAGTTGGTTCCTAAAAAAAAATCAA[C/T]TTCTGTAATATGGAAATGGTTCGGATTTTTGCTAACAGACACAGCGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113139 Nonsense 72 630 2 5
Genomic Location (Zv9):
Chromosome 2 (position 14321256)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14619300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACAACGAACCTTTTTAACCACCTCAAGAGAAAGCACCCGAAAGAATA[T/A]GCAGAGAGTCAAATTTTAAAAGGACCCCACGCAAGTACATCACCAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113139 Nonsense 344 630 5 5
Genomic Location (Zv9):
Chromosome 2 (position 14319666)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14617710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCACTGAGTCCCCAACACGATGGGGTTCAAGTCTCAGCATGATTGAG[C/T]GAGTGCTTGACCAGAAAAAGGCGATTTCTCAGGTCCTGAAGGCAGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113139 Nonsense 369 630 5 5
Genomic Location (Zv9):
Chromosome 2 (position 14319591)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14617635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCAGGTMCTGAAGGCAGACAAGGCAAGGCATTTGGYTCCATCCTGG[C/T]AAGATGTTGACGTGATGGAGTCTGTGAAAAAGGCACTGAGTCCACTRAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link