plagl2

Ensembl ID:
ENSDARG00000076657
ZFIN ID:
ZDB-GENE-020806-1
Description:
zinc finger protein PLAGL2 [Source:RefSeq peptide;Acc:NP_705938]
Human Orthologue:
PLAGL2
Human Description:
pleiomorphic adenoma gene-like 2 [Source:HGNC Symbol;Acc:9047]
Mouse Orthologue:
Plagl2
Mouse Description:
pleiomorphic adenoma gene-like 2 Gene [Source:MGI Symbol;Acc:MGI:1933165]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43916 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114340 Nonsense 351 639 2 2
ENSDART00000115298 Nonsense 300 588 2 2
Genomic Location (Zv9):
Chromosome 23 (position 7666680)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7659143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAAGAAATAAGCCCTATGATGTGTAGCATGGGACCTACCAAGGACT[C/A]AATGATGGCAAAGCCTTTCCACGGTGCCACCCCTTTTCCCATGGGTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link