A3KP79_DANRE

Ensembl ID:
ENSDARG00000076651
Description:
LOC571837 protein [Source:UniProtKB/TrEMBL;Acc:A3KP79]
Human Orthologues:
DYSFIP1, NRARP, PPP1R12A, PPP1R12B, PPP1R12C
Human Descriptions:
dysferlin interacting protein 1 [Source:HGNC Symbol;Acc:16813]
NOTCH-regulated ankyrin repeat protein [Source:HGNC Symbol;Acc:33843]
protein phosphatase 1, regulatory (inhibitor) subunit 12A [Source:HGNC Symbol;Acc:7618]
protein phosphatase 1, regulatory (inhibitor) subunit 12B [Source:HGNC Symbol;Acc:7619]
protein phosphatase 1, regulatory (inhibitor) subunit 12C [Source:HGNC Symbol;Acc:14947]
Mouse Orthologues:
Dysfip1, Nrarp, Ppp1r12a, Ppp1r12b, Ppp1r12c
Mouse Descriptions:
dysferlin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1915951]
Notch-regulated ankyrin repeat protein Gene [Source:MGI Symbol;Acc:MGI:1914372]
protein phosphatase 1, regulatory (inhibitor) subunit 12A Gene [Source:MGI Symbol;Acc:MGI:1309528]
protein phosphatase 1, regulatory (inhibitor) subunit 12B Gene [Source:MGI Symbol;Acc:MGI:1916417]
protein phosphatase 1, regulatory (inhibitor) subunit 12C Gene [Source:MGI Symbol;Acc:MGI:1924258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17726 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110598 Essential Splice Site 152 240 4 13
ENSDART00000122282 Essential Splice Site 154 242 3 12
Genomic Location:
Chromosome 25 (position 5170520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATAATCACGCATGTCAAGCATTTRGTATCCATGTGACCCTCTGCCTC[A/T]GGGTGCTGTTGAAGTGTGGGATAGAYGTGGACAGTCGGGACAGTGACGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8qqdssrh