LOC564389

Ensembl ID:
ENSDARG00000076650
Human Orthologue:
PDE9A
Human Description:
phosphodiesterase 9A [Source:HGNC Symbol;Acc:8795]
Mouse Orthologue:
Pde9a
Mouse Description:
phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2810 Nonsense F2 line generated During 2016
sa42538 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17555 Nonsense Available for shipment Available now
sa11519 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2810
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114937 Nonsense 11 504 1 17
Genomic Location (Zv9):
Chromosome 15 (position 21296084)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22398710
KASP Assay ID:
554-3069.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGTTCATTTCATCAACATGGGGTCTGCCTCCTCCTCTTACTCTCCC[A/T]AAACCATCTATTTGGWTGTAGACGGCAAAGTGCAGAAGGTGAGTGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114937 Essential Splice Site 73 504 3 17
Genomic Location (Zv9):
Chromosome 15 (position 21299801)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22402427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGTGCCATCGTATCCATTGATCCCACCATGCCCACCAACAACCCCAA[G/A]TAAAATGCAGCCCTTGTTGTTTGTAATTGCCATTATGGTAATTTCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114937 Nonsense 339 504 13 17
Genomic Location (Zv9):
Chromosome 15 (position 21305502)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22408128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAATCACCACTGCGCTGTAGCCTTCCAGATACTCTCTCTGCCAGAGTG[T/A]AATATATTTGCYAATGTGGAGCCGGAGGCCTTCAAACAGATTCGGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114937 Essential Splice Site 471 504 16 17
Genomic Location (Zv9):
Chromosome 15 (position 21307784)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22410410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGCTTCATTAAATTTGTCCTCATCCCTATGTTTGAAACGGTCATGAAG[G/A]TAGGTGGAATAAATCAWCYGTGTAAAGTAGAGCTTGCCCAACATTTTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link