si:ch211-241o7.4

Ensembl ID:
ENSDARG00000076644
ZFIN ID:
ZDB-GENE-091117-27
Description:
LOC567267 protein [Source:UniProtKB/TrEMBL;Acc:A5PLH3]
Human Orthologue:
KCNV2
Human Description:
potassium channel, subfamily V, member 2 [Source:HGNC Symbol;Acc:19698]
Mouse Orthologue:
Kcnv2
Mouse Description:
potassium channel, subfamily V, member 2 Gene [Source:MGI Symbol;Acc:MGI:2670981]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111073 Nonsense 327 436 1 2
ENSDART00000136239 Nonsense 409 518 1 2
Genomic Location (Zv9):
Chromosome 10 (position 15340610)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15353917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTACCAACAAGTGGGCTGTCTGTTCCTCTTCATTGCAATGGGAATCT[T/A]AACATTTTCGGCCATGGTGTATACCGTCGAGCATGATGTGCATAAAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link