NFATC2 (1 of 2)

Ensembl ID:
ENSDARG00000076640
Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 [Source:HGNC Symbol;Acc:77
Human Orthologue:
NFATC2
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc2
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112656 Nonsense 187 894 2 10
Genomic Location (Zv9):
Chromosome 23 (position 39198278)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39086641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCCTGCGTTTCGCCCAGTAACAGCCAGCTTTCTGGAGACCTCTGTCCA[C/T]GACTGCAGGGCGTCCATACGGGGTCTCCAAGAACCAGTCCGGGCACTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link