LOC562934

Ensembl ID:
ENSDARG00000076639
Human Orthologues:
C1orf204, ESAM
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
endothelial cell adhesion molecule [Source:HGNC Symbol;Acc:17474]
Mouse Orthologue:
Esam
Mouse Description:
endothelial cell-specific adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1916774]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22618 Nonsense Mutation detected in F1 DNA During 2016
sa32027 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114936 Nonsense 33 436 2 7
Genomic Location (Zv9):
Chromosome 15 (position 18289968)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19453782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTCTTTGCTGCCACAGGTGACTCCCAGCGGGTCGAGATGCCACGT[A/T]AAGACATGGAGGTAATCATGGGGCAAATGGTGGTTCTAGAGGCCTGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114936 Nonsense 77 436 3 7
Genomic Location (Zv9):
Chromosome 15 (position 18278603)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19442417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGTTAAGATGTGTCTTGCTGTTTTCGTAGGTCATTTCATACTCAT[C/A]GGGACAGATTGGCATTGGTAGCCCTGACTTTCGTAAGCGGGTGGGTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link