LOC570311

Ensembl ID:
ENSDARG00000076634
Human Orthologue:
CAPN10
Human Description:
calpain 10 [Source:HGNC Symbol;Acc:1477]
Mouse Orthologue:
Capn10
Mouse Description:
calpain 10 Gene [Source:MGI Symbol;Acc:MGI:1344392]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19864 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109890 Nonsense 334 652 6 11
Genomic Location:
Chromosome 2 (position 45208599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACGGTGGGCTGTCCTGTCAATGATGCAGGACACCTCCAAAGCATCTA[C/A]ACAGGTACTGATTATACCAGAGGCGGACAAAATGTTGAATGCAAAGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1dol3ifh