ptprb

Ensembl ID:
ENSDARG00000076624
ZFIN ID:
ZDB-GENE-101108-3
Description:
protein tyrosine phosphatase, receptor type, b [Source:RefSeq peptide;Acc:NP_001186063]
Human Orthologue:
PTPRB
Human Description:
protein tyrosine phosphatase, receptor type, B [Source:HGNC Symbol;Acc:9665]
Mouse Orthologue:
Ptprb
Mouse Description:
protein tyrosine phosphatase, receptor type, B Gene [Source:MGI Symbol;Acc:MGI:97809]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40334 Nonsense Mutation detected in F1 DNA During 2017
sa40333 Nonsense Mutation detected in F1 DNA During 2017
sa30855 Nonsense Mutation detected in F1 DNA During 2017
sa40332 Nonsense Mutation detected in F1 DNA During 2017
sa30854 Nonsense Mutation detected in F1 DNA During 2017
sa17342 Nonsense Available for shipment Available now
sa44594 Nonsense Mutation detected in F1 DNA During 2017
sa20312 Nonsense Available for shipment Available now
sa26358 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33507 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 62 1892 2 30
Genomic Location (Zv9):
Chromosome 4 (position 59598279)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72913460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGGATAACGCAAACGTGAAATGTCAATACACAGTTTCTGTCAAGGAC[A/T]GACACACAGATTCGAAAGGCTGCCGTCAAGACCGAGAACATTCCAAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 74 1892 2 30
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 74 1892 2 30
Genomic Location (Zv9):
Chromosome 4 (position 59598243)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72913424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTCAAGGACAGACACACAGATTCGAAAGGCTGCCGTCAAGACCGA[G/T]AACATTCCAAGTGCCAAATCGAGAGTTTAGATCCCGGAACGTGGTATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 74 1892 2 30
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 74 1892 2 30
Genomic Location (Zv9):
Chromosome 4 (position 59598243)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72913424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTCAAGGACAGACACACAGATTCGAAAGGCTGCCGTCAAGACCGA[G/T]AACATTCCAAGTGCCAAATCGAGAGTTTAGATCCCGGAACGTGGTATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 411 1892 6 30
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 411 1892 6 30
Genomic Location (Zv9):
Chromosome 4 (position 59567694)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72882875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCGCGCTGTGGGCTCATGCCGCTAGCTCATCGTCCCGCGATGGCTA[C/A]ATCATACAGCTTTTCCAGAGCAACACATCTACAGTTATTCAGACACGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 411 1892 6 30
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 411 1892 6 30
Genomic Location (Zv9):
Chromosome 4 (position 59567694)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72882875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCGCGCTGTGGGCTCATGCCGCTAGCTCATCGTCCCGCGATGGCTA[C/A]ATCATACAGCTTTTCCAGAGCAACACATCTACAGTTATTCAGACACGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 477 1892 7 30
Genomic Location (Zv9):
Chromosome 4 (position 59562598)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72877779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTGTAATCTTGTGCTTTATTCTCAGWGCCTCTGAAGGTGAATCACCTG[A/T]AACTAAGCAACAAGGGGAGTACAGACAGTCTGAATGCAAGCTGGGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 1039 1892 13 30
Genomic Location (Zv9):
Chromosome 4 (position 59541308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGGTGGGCTGGGTGGACGGGTATGAATTATATCTGTACGATCGAGAC[G/T]AGACCCTCCACTATCACACGACCCTGGGGAGTGATGCTCTGGGCTGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Nonsense 1043 1892 13 30
Genomic Location (Zv9):
Chromosome 4 (position 59541294)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72856475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACGGGTATGAATTATATCTGTACGATCGAGACGAGACCCTCCACTA[T/A]CACACGACCCTGGGGAGTGATGCTCTGGGCTGGTCCTTTACACTCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037   None 240 None 7
ENSDART00000127299 Essential Splice Site 1170 1892 15 30
Genomic Location (Zv9):
Chromosome 4 (position 59531589)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72846770
KASP Assay ID:
2259-5209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTACAACAGTTCTGAAACTAAACGACTCTCGTCATTATATCACCAC[A/T]GTCCCCGCAGCGCCATCGTCGGTGTCCGTCAGCTGCTCTGGCGGCTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110037 Essential Splice Site 28 240 None 7
ENSDART00000127299 Essential Splice Site 1646 1892 None 30
Genomic Location (Zv9):
Chromosome 4 (position 59513155)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 72828336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTGCTTGGTAACCGCAACAAAAACCGATACAACAATATACTTCCCTG[T/C]AAGTAGATTAACGGCAACATCTATCAGTTGGAATTCTTCATGTGTAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link