LOC572029

Ensembl ID:
ENSDARG00000076622
Human Orthologue:
ATP13A3
Human Description:
ATPase type 13A3 [Source:HGNC Symbol;Acc:24113]
Mouse Orthologue:
Atp13a3
Mouse Description:
ATPase type 13A3 Gene [Source:MGI Symbol;Acc:MGI:2685387]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35125 Nonsense Mutation detected in F1 DNA During 2016
sa11201 Essential Splice Site Available for shipment Available now
sa41882 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35124 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111702 Nonsense 61 502 2 13
Genomic Location (Zv9):
Chromosome 11 (position 34983351)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33883697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATCTCTCACCGTTTGTGCTCTCTGTTTTCAGGAGGTGGAGATTATTT[T/A]GGAAGATGGTCATTCTGTGGATGAGTCCAGATCTCAGGAACAGTATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111702 Essential Splice Site 98 502 2 13
Genomic Location (Zv9):
Chromosome 11 (position 34983237)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33883583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATCTTTCGCTGTAATTATTGAGCRTTTCCAGGACCTGCTGCAGAAGG[T/C]TAGTNGGCCGCTAAWTCCCCCTAWACTGTATCTCTGTGCATGTGTCAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111702 Essential Splice Site 139 502 4 13
Genomic Location (Zv9):
Chromosome 11 (position 34979302)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33879648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGTTATTTTGTAGGGATGTGTGGTGATGGAGCGAATGACTGTGGGG[T/C]GAGCTGTTTTTATTGTGTTTTTTATACGTCGTCTCTGTGTTGTGGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111702 Nonsense 446 502 13 13
Genomic Location (Zv9):
Chromosome 11 (position 34955175)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 33855728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGTGTGTGTGTCTATAGGGAGGAATAGACATGTATGGATCTAAATG[C/A]CTCTCCTGGCTCTGCTGCCGGCGAAGAAAAGTTCCCAAGGCACGCTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link