LOC562926

Ensembl ID:
ENSDARG00000076620
Human Orthologue:
ABHD8
Human Description:
abhydrolase domain containing 8 [Source:HGNC Symbol;Acc:23759]
Mouse Orthologue:
Abhd8
Mouse Description:
abhydrolase domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1918946]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14685 Nonsense Available for shipment Available now
sa2620 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110033 Nonsense 69 482 1 4
Genomic Location:
Chromosome 11 (position 5973816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKACCTGTGGTTGAGGAGCCRGGGACTGGGGAAGGYGGTACAGTGAGCTG[C/A]AAGCGTAAAATCTCAGTGTACAGAAACGGACAGCTTCTTATTGAGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110033 Essential Splice Site 305 482 3 4
Genomic Location:
Chromosome 11 (position 5970617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTTTNNNNNNNNNNNNGTACTAACGAAGATGCATTTCCCCCTCTTTA[A/G]GGGCTGGGTTTGCCCATCAGRGAACAAGGGAAAAGAAATTACTGAAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A locus on 19p13 modifies risk of breast cancer in BRCA1 mutation carriers and is associated with hormone receptor-negative breast cancer in the general population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/99oisuai