tm2d3

Ensembl ID:
ENSDARG00000076618
ZFIN ID:
ZDB-GENE-070620-20
Description:
TM2 domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:A5PLF5]
Human Orthologue:
TM2D3
Human Description:
TM2 domain containing 3 [Source:HGNC Symbol;Acc:24128]
Mouse Orthologue:
Tm2d3
Mouse Description:
TM2 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915884]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23200 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111735 Nonsense 6 260 1 6
ENSDART00000136693 None None 244 1 6

The following transcripts of ENSDARG00000076618 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 329472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACTCGGTCAAACGGCGGAAGCAGTGTTTCACGATGACGGCGAACGGA[C/T]AGAAATGGGTTCTAGATCGCGGACGGAATAAAATGAGCTCGTATATAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n732863d