fbxo21

Ensembl ID:
ENSDARG00000076611
ZFIN ID:
ZDB-GENE-100922-229
Human Orthologue:
FBXO21
Human Description:
F-box protein 21 [Source:HGNC Symbol;Acc:13592]
Mouse Orthologue:
Fbxo21
Mouse Description:
F-box protein 21 Gene [Source:MGI Symbol;Acc:MGI:1924223]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33541 Nonsense Mutation detected in F1 DNA During 2016
sa10928 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111359 Nonsense 76 611 2 12

The following transcripts of ENSDARG00000076611 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 12904591)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11315994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTGAAAAGTGCTTTACAAACATACTTGAATTGAATTGTTTCAGATG[G/A]CCCAGACTGCAGAGATTTTACCGGCAGAATGAATCATACGATTGGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111359 Essential Splice Site 292 611 6 12

The following transcripts of ENSDARG00000076611 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 12909904)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11321307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAATGAGCGAGACTACTACAATCCACTCAACTCATACATACATCAGG[T/C]ACACCWCTCATATCAATATCATATTGCAAAAWACTCTATTTAGGTGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link