B3DFT5_DANRE

Ensembl ID:
ENSDARG00000076609
Description:
Si:ch211-199g17.1 [Source:UniProtKB/TrEMBL;Acc:B3DFT5]
Human Orthologues:
SYCE1, SYCE1L
Human Descriptions:
synaptonemal complex central element protein 1 [Source:HGNC Symbol;Acc:28852]
synaptonemal complex central element protein 1-like [Source:HGNC Symbol;Acc:37236]
Mouse Orthologues:
Syce1, Syce1l
Mouse Descriptions:
synaptonemal complex central element protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921325]
synaptonemal complex central element protein 1 like Gene [Source:MGI Symbol;Acc:MGI:1922247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110305 Nonsense 177 206 10 10
Genomic Location (Zv9):
Chromosome 19 (position 44972640)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44015415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAATCGGATATTTTACTGTGTGTTTGTGTGTCTGTCCCAACAGAGCAA[C/T]AGAAGCTGGAGCAGTTGGCCAAGCTGCTGGACGAGTTAAACCACACCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link