C1J0C6_DANRE

Ensembl ID:
ENSDARG00000076601
Description:
Cdc42 guanine nucleotide exchange factor 9 [Source:UniProtKB/TrEMBL;Acc:C1J0C6]
Human Orthologue:
ARHGEF9
Human Description:
Cdc42 guanine nucleotide exchange factor (GEF) 9 [Source:HGNC Symbol;Acc:14561]
Mouse Orthologue:
Arhgef9
Mouse Description:
CDC42 guanine nucleotide exchange factor (GEF) 9 Gene [Source:MGI Symbol;Acc:MGI:2442233]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35637 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110020 Nonsense 100 513 2 9
ENSDART00000128725   None 235 None 6
Genomic Location (Zv9):
Chromosome 14 (position 9348207)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8871550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGACCCTAGCAACGGCTGCCTGTGCATTGGCCAACCGCTGCAGAAT[C/T]GAGATCAGATGAGGGCTAATGTTATCAATGAGATCATGAGTACTGAGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link