si:ch211-117n7.1

Ensembl ID:
ENSDARG00000076595
ZFIN ID:
ZDB-GENE-060503-381
Description:
Semaphorin 4g [Source:UniProtKB/TrEMBL;Acc:B6E510]
Human Orthologue:
SEMA4G
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4g
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42144 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22232 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111365 Essential Splice Site 305 839 8 14

The following transcripts of ENSDARG00000076595 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 9105542)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9408162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGCTCTCAGGACTCTGCTTTCTATGGCATATTTGGCTTGGAATGG[T/C]AAGAGCACTTTTTCTTTTAATGTTTGTTTTGCATTATTGGCTATGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111365 Nonsense 655 839 14 14

The following transcripts of ENSDARG00000076595 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 9124758)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9427378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACAACCACGCTTCACCACAGAAATCTATTGGACCAGTCAGTCTTCC[C/T]AAAGCGACTCCGAGGAAGACTTCGACCCCACCCCGATGTCTCCTCGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link