PCDH12

Ensembl ID:
ENSDARG00000076594
Description:
protocadherin 12 [Source:HGNC Symbol;Acc:8657]
Human Orthologue:
PCDH12
Human Description:
protocadherin 12 [Source:HGNC Symbol;Acc:8657]
Mouse Orthologue:
Pcdh12
Mouse Description:
protocadherin 12 Gene [Source:MGI Symbol;Acc:MGI:1855700]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22439 Nonsense Available for shipment Available now
sa42363 Nonsense Mutation detected in F1 DNA During 2017
sa22438 Nonsense Available for shipment Available now
sa35653 Nonsense Mutation detected in F1 DNA During 2017
sa38984 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111262 Nonsense 426 1174 1 4
Genomic Location (Zv9):
Chromosome 14 (position 14015254)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16021401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATGATTGTAACCAATGGCACTCTGGATCGTGAGAAACAAATGGAATA[T/A]AACCTTACTCTTCTCGCTCAAGACAGTGGTGATCCATCTCTGTCCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111262 Nonsense 570 1174 1 4
ENSDART00000111262 Nonsense 570 1174 1 4
Genomic Location (Zv9):
Chromosome 14 (position 14014822)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16020969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGCTGGTTGAAATACAGGATGTTAATGACAATTACCCCATAATTTA[T/G]GAGCCTCTACCCAAGAAGGGGATTGCATTGCTAAATGTCCCAGTGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111262 Nonsense 570 1174 1 4
ENSDART00000111262 Nonsense 570 1174 1 4
Genomic Location (Zv9):
Chromosome 14 (position 14014822)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16020969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGCTGGTTGAAATACAGGATGTTAATGACAATTACCCCATAATTTA[T/G]GAGCCTCTACCCAAGAAGGGGATTGCATTGCTAAATGTCCCAGTGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111262 Nonsense 731 1174 1 4
Genomic Location (Zv9):
Chromosome 14 (position 14014339)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16020486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGTATAGCTTTACAATGCTTTTGGCCATCTGCCTTGGATCTACCTG[T/A]CTGGTATTATTTTTAATCATTGCTTTAGCCAAGACATTCTGTCACCCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111262 Nonsense 966 1174 1 4
Genomic Location (Zv9):
Chromosome 14 (position 14013636)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16019783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTGCAGAAAACGGTTCTTTTGAACTATCTTCTGCCTCACCTGAAGTG[C/T]AAGTATGAAAACTTTCCATTTTTACTTATAGCTTATTAATTTACAATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link