man1b1

Ensembl ID:
ENSDARG00000076592
ZFIN ID:
ZDB-GENE-070705-482
Description:
alpha 1,2-mannosidase [Source:RefSeq peptide;Acc:NP_001093449]
Human Orthologue:
MAN1B1
Human Description:
mannosidase, alpha, class 1B, member 1 [Source:HGNC Symbol;Acc:6823]
Mouse Orthologue:
Man1b1
Mouse Description:
mannosidase, alpha, class 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2684954]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18802 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8188 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14234 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109926 Essential Splice Site 34 632 3 14
ENSDART00000109926 Essential Splice Site 34 632 3 14

The following transcripts of ENSDARG00000076592 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30832170)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAATGTGTTTGCACAAATGTGATTTTGCGGCGTTATTTTTATTTTCC[A/G]GAAATGGAAACAGCTGTCCAGATTGCAGCGCAGCCTGATTCTGCTTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109926 Essential Splice Site 34 632 3 14
ENSDART00000109926 Essential Splice Site 34 632 3 14

The following transcripts of ENSDARG00000076592 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30832170)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAARTGTGTTTGCACAAATGTGATTTTGCKGCGTTATTTTTATTTTCC[A/G]GAAATGGAAACAGCTGTCCAGATTGCAGCGCAGCCTGATTCTGCTTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109926 Essential Splice Site 351 632 9 14

The following transcripts of ENSDARG00000076592 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 30827729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGTTCAGAGAGCTCAGCMGACTCACTGGAGACCCCAAATACAAGG[T/G]CAAACACAATTGKTGGTTTTTCTCCARTTCACATTTTTATTATTRAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tytm2s5c