man1b1

Ensembl ID:
ENSDARG00000076592
ZFIN ID:
ZDB-GENE-070705-482
Description:
alpha 1,2-mannosidase [Source:RefSeq peptide;Acc:NP_001093449]
Human Orthologue:
MAN1B1
Human Description:
mannosidase, alpha, class 1B, member 1 [Source:HGNC Symbol;Acc:6823]
Mouse Orthologue:
Man1b1
Mouse Description:
mannosidase, alpha, class 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2684954]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14234 Essential Splice Site Available for shipment Available now
sa40449 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109926 Essential Splice Site 351 632 9 14

The following transcripts of ENSDARG00000076592 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30827729)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28589086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGTTCAGAGAGCTCAGCMGACTCACTGGAGACCCCAAATACAAGG[T/G]CAAACACAATTGKTGGTTTTTCTCCARTTCACATTTTTATTATTRAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109926 Nonsense 495 632 12 14

The following transcripts of ENSDARG00000076592 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 30824704)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28586061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGGAGCTTGCGAAACAGCTGATAGAGACCTGCTACCAGATGTATGCA[C/T]AGATGGAGACCGGTCTGAGTCCAGAAATAGCCCATTTCAACATGCACGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link