LOC563039

Ensembl ID:
ENSDARG00000076590
Human Orthologue:
ATAD2
Human Description:
ATPase family, AAA domain containing 2 [Source:HGNC Symbol;Acc:30123]
Mouse Orthologue:
Atad2
Mouse Description:
ATPase family, AAA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917722]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42802 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6447 Nonsense Mutation detected in F1 DNA During 2016
sa4680 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14615 Nonsense Available for shipment Available now
sa994 Nonsense Available for shipment Available now
sa42803 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111963 Essential Splice Site 181 1358 5 28
Genomic Location:
Chromosome 16 (position 46274029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCAGAAGATGCGTCGTAGACTGAGGAGCAGAGACAGTGAGGAGGAGG[T/A]GCGTCGTGATCTTCATCACTGATTCCTGCAGTAAGGCTTTGATCAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111963 Nonsense 357 1358 11 28
Genomic Location:
Chromosome 16 (position 46276213)
KASP Assay ID:
554-4182.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATAAACTAAWCACNNNACCTTTTGTAGATGCCTCCCTATGAATTTA[C/T]GAAAGGAYGATCTGTTAGGAATCCACAAGGACAGGATTAAAATCGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111963 Essential Splice Site 386 1358 11 28
Genomic Location:
Chromosome 16 (position 46276304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCGGAGCAAGTCTTGCAGATGTTGACCCAATGCAGATTGACCAAACAG[T/C]RCGTATTTGCCATTTGASTTGCAAGAGTGGTAAAAACCTGTATTTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111963 Nonsense 395 1358 12 28
Genomic Location:
Chromosome 16 (position 46276398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGTTGTGRCTCTTGTGTACAGGTGCGCTTCGACAGCATTGGGGGTT[T/A]GGGAAAACACATCTCTGCACTGAAGGAAATGGTTGTGTTTCCTTTACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111963 Nonsense 430 1358 13 28
Genomic Location:
Chromosome 16 (position 46276597)
KASP Assay ID:
554-0898.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCTTTATTGACCGAATGTTATGTGTTTTCAGAGGATGTCTGTTCTA[T/G]GGCCCTCCTGGMACAGGAAAGACTCTTGTYGCTCGAGCCCTAGCCAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111963 Nonsense 1116 1358 25 28
Genomic Location:
Chromosome 16 (position 46282818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGACACCCAGTAAAGAAGCTACACCTCTGTCAGCACAAGCTGTGATTT[C/A]ACCACGTCAAGCAGGAATTAATACAGGTTACTGACAAAGCTGGCAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link