csf2rb

Ensembl ID:
ENSDARG00000076586
ZFIN ID:
ZDB-GENE-080115-1
Description:
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) [Source:RefSeq pe
Human Orthologue:
CSF2RB
Human Description:
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) [Source:HGNC Symbo
Mouse Orthologues:
Csf2rb, Csf2rb2
Mouse Descriptions:
colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) Gene [Source:MGI
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) Gene [Source:MGI S

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19999 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19998 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115283 Essential Splice Site 74 696 2 13
Genomic Location:
Chromosome 3 (position 24620432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATCCACGTGCTAACTTCACTTTGTATTACTATGACAAATATAAGAA[G/A]TAGGTGATGAAAGACACAATAGATGAAATAAAGTGACAGGAATGAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115283 Nonsense 501 696 11 13
Genomic Location:
Chromosome 3 (position 24610514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCTTATGGAAGGGATCGATTCCATCACCCATAAAGAGCAAAGTACTC[G/T]AGGGGGTGATCAAGGTGAGCCTTTATTGACTGATCTTGCAAGTGTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/brko3wxn