csf2rb

Ensembl ID:
ENSDARG00000076586
ZFIN ID:
ZDB-GENE-080115-1
Description:
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) [Source:RefSeq pe
Human Orthologue:
CSF2RB
Human Description:
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) [Source:HGNC Symbo
Mouse Orthologues:
Csf2rb, Csf2rb2
Mouse Descriptions:
colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) Gene [Source:MGI
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) Gene [Source:MGI S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19999 Essential Splice Site Available for shipment Available now
sa33163 Nonsense Mutation detected in F1 DNA During 2016
sa19998 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115283 Essential Splice Site 74 696 2 13
Genomic Location (Zv9):
Chromosome 3 (position 24620432)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24198643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATCCACGTGCTAACTTCACTTTGTATTACTATGACAAATATAAGAA[G/A]TAGGTGATGAAAGACACAATAGATGAAATAAAGTGACAGGAATGAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115283 Nonsense 126 696 3 13
Genomic Location (Zv9):
Chromosome 3 (position 24620188)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24198399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACACCCTATACTTCAAAGTACAATGTGGAAATACTCCCACATCTCTC[C/T]GAGTTGCTCAGCATGGTAAGTGTGTTTCGTGAATGCATTTACCTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115283 Nonsense 501 696 11 13
Genomic Location (Zv9):
Chromosome 3 (position 24610514)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24188725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCTTATGGAAGGGATCGATTCCATCACCCATAAAGAGCAAAGTACTC[G/T]AGGGGGTGATCAAGGTGAGCCTTTATTGACTGATCTTGCAAGTGTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link