KCNK17

Ensembl ID:
ENSDARG00000076580
Description:
potassium channel, subfamily K, member 17 [Source:HGNC Symbol;Acc:14465]
Human Orthologue:
KCNK17
Human Description:
potassium channel, subfamily K, member 17 [Source:HGNC Symbol;Acc:14465]
Mouse Orthologue:
Kcnk16
Mouse Description:
potassium channel, subfamily K, member 16 Gene [Source:MGI Symbol;Acc:MGI:1921821]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14168 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114615 Nonsense 35 299 1 5
Genomic Location:
Chromosome 17 (position 48898547)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTCWATCCTTTTTCTTGGAGTTTTTTATGTCGCTTATGTTCTTGTC[G/T]GAGGGCTGGTATTCTGGAAGCTAGAAGGATGGTATGTGTTGCAACAGAYT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xd6p08i0