crygm2d7

Ensembl ID:
ENSDARG00000076572
ZFIN ID:
ZDB-GENE-060918-5
Description:
crystallin, gamma M2d7 [Source:RefSeq peptide;Acc:NP_001038572]
Human Orthologues:
CRYGA, CRYGB, CRYGC, CRYGD
Human Descriptions:
crystallin, gamma A [Source:HGNC Symbol;Acc:2408]
crystallin, gamma B [Source:HGNC Symbol;Acc:2409]
crystallin, gamma C [Source:HGNC Symbol;Acc:2410]
crystallin, gamma D [Source:HGNC Symbol;Acc:2411]
Mouse Orthologues:
Cryga, Crygb, Crygc, Crygd, Cryge, Crygf
Mouse Descriptions:
crystallin, gamma A Gene [Source:MGI Symbol;Acc:MGI:88521]
crystallin, gamma B Gene [Source:MGI Symbol;Acc:MGI:88522]
crystallin, gamma C Gene [Source:MGI Symbol;Acc:MGI:88523]
crystallin, gamma D Gene [Source:MGI Symbol;Acc:MGI:88524]
crystallin, gamma E Gene [Source:MGI Symbol;Acc:MGI:88525]
crystallin, gamma F Gene [Source:MGI Symbol;Acc:MGI:88526]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9600 Essential Splice Site Available for shipment Available now
sa8656 Essential Splice Site Available for shipment Available now
sa25425 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113174 Essential Splice Site 2 173 1 3
ENSDART00000113174 Essential Splice Site 2 173 1 3

The following transcripts of ENSDARG00000076572 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23305352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCTCCCTTGTGAAACCACTGAGAATAATCCARTGCAAACATGAAG[G/A]TAAATCTCATTCTATYACCCACTCCAAACAGTAAAACTAAAATGATAWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113174 Essential Splice Site 2 173 1 3
ENSDART00000113174 Essential Splice Site 2 173 1 3

The following transcripts of ENSDARG00000076572 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23305352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCTCCCTTGTGAAACCACTGAGAATAATCCARTGCAAACATGAAG[G/A]TAAATCTCATTCTATYACCCACTCCAAACAGTAAAACTAAAATGATAWAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113174 Nonsense 89 173 3 3

The following transcripts of ENSDARG00000076572 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 23304888)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAACTTGAAAATGATGAACTCTTCCACTACAGCACAGGGGATCCTAC[A/T]GAATGAGGATCTATGAGAGGGAGAACTTCGGAGGTCAGATGTACGAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/61beloq5