GPR151

Ensembl ID:
ENSDARG00000076565
Description:
G protein-coupled receptor 151 [Source:HGNC Symbol;Acc:23624]
Human Orthologue:
GPR151
Human Description:
G protein-coupled receptor 151 [Source:HGNC Symbol;Acc:23624]
Mouse Orthologue:
Gpr151
Mouse Description:
G protein-coupled receptor 151 Gene [Source:MGI Symbol;Acc:MGI:2441887]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11004 Nonsense Available for shipment Available now
sa17155 Nonsense Available for shipment Available now
sa22251 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109853 Nonsense 209 396 2 4
ENSDART00000109853 Nonsense 209 396 2 4
Genomic Location:
Chromosome 13 (position 15131116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTYAACTCCCAAGATGCAATGCGAATATTCMATAAGTTGCTGCCAT[T/G]AGGCATCTACRTTCTTCCGGTCAYCCTCTCTGCTGTGAGCCACATTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109853 Nonsense 209 396 2 4
ENSDART00000109853 Nonsense 209 396 2 4
Genomic Location:
Chromosome 13 (position 15131116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTYAACTMCCAAGATGCAATGCGAATATTCMATAAGTTGCTGCCAT[T/G]AGGCATCWACRTTCTTCCGGTCAYCCTCTCTGCTGTGAGCCACATTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109853 Nonsense 247 396 3 4
Genomic Location:
Chromosome 13 (position 15131242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGACGAAGCTTTTTTTTCACGCCAGTATGAGAATTCCTTAATGTATT[T/A]AAGCATCATTGCCATCAACACGCTCCTGATGCTTCCCGAATGGGTGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kwb1e572