hspg2

Ensembl ID:
ENSDARG00000076564
ZFIN ID:
ZDB-GENE-080807-4
Description:
Heparan sulfate proteoglycan 2 [Source:UniProtKB/TrEMBL;Acc:B2RZI0]
Human Orthologue:
HSPG2
Human Description:
heparan sulfate proteoglycan 2 [Source:HGNC Symbol;Acc:5273]
Mouse Orthologue:
Hspg2
Mouse Description:
perlecan (heparan sulfate proteoglycan 2) Gene [Source:MGI Symbol;Acc:MGI:96257]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24350 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24349 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5051 Nonsense Mutation detected in F1 DNA During 2014
sa4251 Nonsense Mutation detected in F1 DNA During 2014
sa5052 Nonsense Mutation detected in F1 DNA During 2014
sa15637 Essential Splice Site Available for shipment Available now
sa13580 Essential Splice Site Available for shipment Available now
sa417 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Essential Splice Site 866 3422 20 81
ENSDART00000112124 Essential Splice Site 866 3397 20 77
Genomic Location:
Chromosome 23 (position 26870634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGGGAGTGACTAAACAGTGTGCCAGTTCAACCTGGAGCAGAGATCAG[G/A]TAACAGAAAAACGTCCAAATCACTTACATTTTCAGTTATGTCAATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Essential Splice Site 1140 3422 26 81
ENSDART00000112124 Essential Splice Site 1140 3397 26 77
Genomic Location:
Chromosome 23 (position 26862309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCACAGGCTTGTCGACCCTGTCCATGTCTGGGACAAACCAGTAACCA[G/A]TGAGTTATCCTTATTCTTAATCAAAAGTATTATGAAGAGTTTACCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Nonsense 1219 3422 30 81
ENSDART00000112124 Nonsense 1219 3397 30 77
Genomic Location:
Chromosome 23 (position 26855616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAAGCAAACTTTTTTNGTACTTAGATGAACGTTGAGGGTCCAACATG[T/A]TCCTCCTGCAAGCAAGGAACCTTCCACCTTAGTCCAGCTAACAAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Nonsense 1375 3422 33 81
ENSDART00000112124 Nonsense 1375 3397 33 77
Genomic Location:
Chromosome 23 (position 26845933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGGTGGCACGGCAAATATGGCAAAGAGGTCACGGTGCACGGGAGTCA[C/T]AGGACTTTGAGATTGTCTTCAGAGAGGTGCGAACTCATTCATAATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 None None 3422 None 81
ENSDART00000112124 Nonsense 1597 3397 39 77
Genomic Location:
Chromosome 23 (position 26840023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTGTTTGTATGTTGTCAGATGCTGCTTTTCTGGTGGTRAAGGTTTA[T/A]CCAGAAAGGGTTCAGGTGGYACAGGGTCTGCCCGTCACTCTTAGGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Essential Splice Site 3228 3422 75 81
ENSDART00000112124 Essential Splice Site 3203 3397 71 77
ENSDART00000111029 Essential Splice Site 3228 3422 75 81
ENSDART00000112124 Essential Splice Site 3203 3397 71 77
Genomic Location:
Chromosome 23 (position 26794634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCTTCAGCGAGGCCATGTGGAGTTTGGAGGGTAGTGGGGGAAATGG[T/C]ACAGTATGAATTACAGTCTGCCTGACTCGCTCGTCACTAACMAGAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Essential Splice Site 3228 3422 75 81
ENSDART00000112124 Essential Splice Site 3203 3397 71 77
ENSDART00000111029 Essential Splice Site 3228 3422 75 81
ENSDART00000112124 Essential Splice Site 3203 3397 71 77
Genomic Location:
Chromosome 23 (position 26794634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCTTCAGCGAGGCCATGTGGAGTTTGGAGGGTAGTGGGGGAAATGG[T/C]ACAGTATGAATTACAGTCTGCCTGACTCGCTCGTCACTAACMAGAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111029 Nonsense 3276 3422 77 81
ENSDART00000112124 Nonsense 3251 3397 73 77
Genomic Location:
Chromosome 23 (position 26789073)
KASP Assay ID:
554-0277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATTGAGTTAGAGATCAACACTGCCTCAAAGGACGGCCTCATCCTGTG[G/A]CAGGGAGTGGTATGTTTGTACAAATGTGCGCCCTTGTCTTCCCATGACAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e6hyps96