DOCK2

Ensembl ID:
ENSDARG00000076562
Description:
dedicator of cytokinesis 2 [Source:HGNC Symbol;Acc:2988]
Human Orthologue:
DOCK2
Human Description:
dedicator of cytokinesis 2 [Source:HGNC Symbol;Acc:2988]
Mouse Orthologue:
Dock2
Mouse Description:
dedicator of cyto-kinesis 2 Gene [Source:MGI Symbol;Acc:MGI:2149010]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18092 Essential Splice Site Available for shipment Available now
sa42326 Nonsense Mutation detected in F1 DNA During 2017
sa35622 Nonsense Mutation detected in F1 DNA During 2017
sa7387 Missense Mutation detected in F1 DNA During 2017
sa22408 Nonsense Available for shipment Available now
sa42325 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14649 Nonsense Available for shipment Available now
sa35621 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22407 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Essential Splice Site 327 1739 10 73
Genomic Location (Zv9):
Chromosome 14 (position 1564982)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1623118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATAAYAAGAAATGCACGATGGGTCTGCGGAGGCCRTTCGGCGTCGCTG[G/A]TAAATACCATAAAAATATACACTCCTCAGCCACTTTATTAGGTACWCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Nonsense 376 1739 12 73
Genomic Location (Zv9):
Chromosome 14 (position 1562860)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1620996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCTTACACACTCTGCTGAATAAAGTGACGACGACGCGTGGTGACAGT[G/T]GAGGACAAGGTACGACTTGCTGCTCTGATCTCTGAGAAAATGATGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Nonsense 619 1739 18 73
Genomic Location (Zv9):
Chromosome 14 (position 1552983)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1611119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTACATTAATAAAATAATGCATCTGTCTGTGTGTCTGTCAGTGGGTT[T/A]GTTGGGTCTGCTGAAGTGGAGAACTCGTCCTGAGATGCTGAAGAAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Missense 721 1739 21 73
Genomic Location (Zv9):
Chromosome 14 (position 1550108)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1608244
KASP Assay ID:
554-4227.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATTWAATGTGTGCTTTAGGAAGCTGATGTCGGTGTTGAAGACTTATC[T/A]GGATGTGTCGAGTCGCGGCGAGGCCTGTGAACCCATCCTGAGGACACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Nonsense 849 1739 27 73
Genomic Location (Zv9):
Chromosome 14 (position 1537075)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1595211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGTGAGCTCCATGACTGAGATAGTGGGCAGCAGACTCTTCCATAGA[C/T]AAGGTGAAACACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Essential Splice Site 989 1739 36 73
Genomic Location (Zv9):
Chromosome 14 (position 1497772)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1555908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGCAGGCGCTGCTGTTTTCTACACAAATGCAAATCCAGTTATTTCC[G/A]TATTGCATTTGAACGTCGACAGTTTCTGCCGGCTGTAAATCTGTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Nonsense 1314 1739 61 73
Genomic Location (Zv9):
Chromosome 14 (position 1453476)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1496344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACYCTGTGTAAGGAGTTGRCAGATCAGTTTGAGATGGAGGTCTTCGACTA[C/A]GAGCTCCTCGGACAGAAACTGGTAACACACACAYACANNACACACACCTTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Essential Splice Site 1404 1739 63 73
Genomic Location (Zv9):
Chromosome 14 (position 1452973)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1495841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATCACCACCATGCCTGGAGACGACATCAAAAACTCCAACATGCAGTG[T/C]ATCCTGCAGTATAATATTTATAATACTTTTTTGTTGCCATTCTTGTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115295 Essential Splice Site 1489 1739 67 73
Genomic Location (Zv9):
Chromosome 14 (position 1449930)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1492798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCATTATTTGGAAGAATAAGGTCAATGAGTATCGTTATTTTTTCCA[C/A]CAGACCACGATCAGTCCTCTGGAGAATGCCATTGAGACGATGGGACAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link